Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

Clostridium difficile stool shedding in infants hospitalized in two neonatal intensive care units is lower than previous point prevalence estimates using molecular diagnostic methods

BMC Pediatrics volume 18, Article number: 137 (2018) Cite this article

Abstract

Background

The point prevalence of Clostridium difficile stool shedding in hospitalized infants from two neonatal intensive care units (NICUs) was examined utilizing standard clinical testing compared with duplex PCR to identify toxigenic and non-toxigenic C. difficile strains.

Methods

All infants from the two NICUs affiliated with a single academic medical center were eligible for inclusion. Stool collection was blinded to patient characteristics and occurred during a one week period at each NICU and repeated with a second weeklong collection 6 months later to increase sample size. Stools were tested for C. difficile using EIA (GDH/toxin A/B) with samples testing +/+ or +/− subsequently evaluated by Loop-Mediated Isothermal Amplification (LAMP) and by duplex PCR amplification of tcdB and tpi (housekeeping) genes. Cytotoxicity assays were performed on all samples positive for C. difficile by any modality.

Results

Eighty-four stools were collected from unique infants for evaluation. EIA results showed 6+/+ [7.1%], 7 +/− [8.3%], and 71 −/− [84.5%] samples. All 6 EIA +/+ were confirmed as toxigenic C. difficile by LAMP; 6/7 EIA +/− were negative by LAMP with one identified as invalid. Duplex PCR concurred with LAMP in all 6 stools positive for toxigenic C. difficile. PCR identified 2 EIA −/− stools positive for tpi, indicating shedding of non-toxigenic C. difficile. Cytotoxicity assay was positive in 4/6 duplex PCR positive samples and negative for all stools that were EIA +/− but negative by molecular testing.

Conclusions

C. difficile blinded point prevalence in infants from two NICUs was 7.1% by molecular methods; and lower than expected based on historical incidence estimates. In house duplex PCR had excellent concordance with clinically available LAMP and EIA tests, and added detection of non-toxigenic C. difficile strain shedding. Evolving NICU care practices may be influencing the composition of infant gut microbiota and reducing the point prevalence of C. difficile shedding in NICU patient stools.

Peer Review reports

Background

The epidemiology of Clostridium difficile infection (CDI) has shifted in the last decade and is now affecting populations previously at low risk to include healthy adults, peripartum women and young children [1]. Based on several recent studies, traditional risk factors for CDI, including antimicrobial exposure and recent hospitalization are absent in a major proportion of cases [2,3,4]. These epidemiological shifts in CDI have prompted renewed investigation into potential reservoirs and vectors for transmission. Asymptomatic shedders of C. difficile, including infants, have been suggested as playing a role [5,6,7,8,9,10,11]. A single-center study demonstrated that based on multilocus variable number of tandem repeats analysis (MLVA), 29% of hospital acquired CDI (HA-CDI) cases were highly related to C. difficile isolates from asymptomatic patients that were collected before the HA-CDI isolate [7]. A more recent investigation noted that asymptomatic C. difficile carriers increased the risk of nosocomial CDI in other hospitalized patients [12]. A wide range of asymptomatic colonization rates with toxigenic and non-toxigenic C. difficile have been reported in both hospitalized and community-dwelling infants from 11 to 71% [8, 10, 13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29]. NICU infants have been reported to have a prevalence of C. difficile colonization of between 15 and 78% based on several previously published studies performed in the U.S. and elsewhere [13, 18,19,20, 25, 30,31,32,33,34,35,36,37,38,39,40,41,42] (see Table 1). These studies also showed that confirmation testing using the cytotoxicity assay or PCR showed prevalence of toxigenic C. difficile to range from 0 to 67%.

Table 1 Prior NICU studies examining C. difficile prevalence
Full size table

During the last three decades substantial advances in NICU care have occurred. These include earlier feeding, emphasis on human milk feedings, use of more broad-spectrum antibiotics as well as additional efforts to control antimicrobial exposure through stewardship, and the survival of very low birth weight infants with prolonged, complicated hospital stays. Despite these important medical practice changes and the evolution of more precise molecular laboratory tests for toxigenic C. difficile, the prevalence of C. difficile has not been re-evaluated in U.S. NICU settings with molecular technology.

We examined the current point prevalence of C. difficile stool shedding in hospitalized infants from two affiliated NICUs utilizing a rapid and novel duplex PCR which was developed and validated in our laboratory [43]. This duplex PCR detected the presence of two genes, (tpi and tcdB) and we proposed the NICU as a high prevalence unit for validation of the PCR method.

All C. difficile strains, toxigenic and non-toxigenic, possess the housekeeping gene tpi (triose phosphatase isomerase). The tcdB gene encodes for the C. difficile toxin B. A non-toxigenic strain was defined as the detection of the tpi gene alone while a toxigenic strain was defined as the detection of both tpi and tcdB genes. We hypothesized that with both the epidemiologic changes in CDI as well as the advances in NICU care, the prevalence of C. difficile stool shedding may be rising, and heighten concerns for risk to hospital patients and the hospital environment.

Methods

All infants hospitalized in two NICUs (NICU A and B) producing stool during the study period were included in the point prevalence survey. The institutional IRB reviewed and approved the protocol and waived informed consent as no patient identifiers were maintained for the study.

Collection of the stool samples occurred over two separate weeks in each NICU. At NICU A, stool samples were collected in March and in September; at NICU B, stool samples were collected in April and in September. NICU A is a Level III, 36-bed NICU and NICU B is a Level IV, 42-bed NICU. At the beginning of each study week and at the time of any new NICU admission during the study week, five sticker labels containing unique study numbers were placed at the bedside of each NICU patient. Each NICU bedside nurse collected patient’s stool soiled diapers, placed the diaper in a sealed container labeled with the study number and date and subsequently deposited the specimen container into a specially labeled bin located in the NICU. Nurses were instructed to collect up to five stool soiled diapers per patient. This collection methodology ensured patient non-duplication at the clinical level with blinding of the study team. Each NICU had a neonatologist on the study team who was also able to ensure non-duplication and who did not have access to the stool results on a per patient level. A study researcher collected the stool samples from the bin periodically each day and transported them to the research laboratory.

Stool from each NICU patient’s soiled diapers was divided into five 1 mL aliquots and frozen at − 200 C until DNA extraction and PCR testing. The procedure is briefly described: DNA extraction was performed with liquid stool combined with lysis reagents and processed in a 1 ml-capacity lysis microreactor (LMR) which employed intense mixing with heating resulting in bacterial cell lysis. A surface-treated polystyrene strip bound DNA released by lysis from the mixture and permitted transfer of the DNA on the strip to the PCR cuvette. A rapid thermocycler (Philisa Thermal Cycler, Streck, Inc., Omaha, NE) was used to specifically amplify a conserved region of both toxigenic and non-toxigenic C. difficile tpi gene and a non-repeat region of the toxigenic C. difficile tcdB gene using primers designed using online multiplex PCR primer design software called “Primo Multiplex 3.4”. (http://www.changbioscience.com/primo/primoml.html). The forward tpi gene primer was TATATGTGCACCATTTACTTTATT and the tpi reverse primer was AACTTTACAAACATCTTTAGTTTTT, generating a 320 bp PCR product. The forward tcdB gene primer was TTAGCAGGAATTTCAGCAGGT and the reverse tcdB gene primer was ATGACCTGAACCACCTTCCA, generating a 249 bp product. Each 25 μl reaction contained a final concentration of 0.2 mM dNTPs, 5.5 mM MgSO4, 0.5 U KOD Hot Start DNA polymerase, 1X PCR buffer (PCR kit, EMD Chemicals, Inc), 0.4 mg/ml BSA (Ambion, Inc), 0.2 μM forward and 0.2 μM reverse primers (Sigma-Aldrich, St. Louis, MO). Amplification was completed in 19 min as more fully described in a previous study [43]. The thermal protocol included an enzyme activation step at 95 °C for 30 s followed by 45 cycles of 95 °C for 6 s and 56 °C for 6 s, and 72 °C for 6 s. Gel electrophoresis was utilized for identifying bands corresponding to the molecular weights for tpi and tcdB amplified fragments (Fig. 1).

Fig. 1
figure 1

Gel electrophoresis examples for C. difficile tpi and tcdB results reporting. a. Control gel showing tpi +/tcdB +. b. Example of tpi +/tcdB – gel (with control). c. Example of tpi +/tcdB + gel (with control)

Full size image

All stool samples were additionally tested for C. difficile antigen glutamate dehydrogenase (GDH and C. difficile toxins A and/or B by enzyme immunoassay (EIA) (C. diff Quik Chek Complete, Alere Inc., Waltham, MA). Samples that were discordant (+/−) or positive/positive (+/+) for GDH and toxins A/B had reflex testing using LAMP technology (illumigene®, Meridian Bioscience, Inc., Cincinnati, OH). These commercially available tests were performed by the hospital clinical laboratory for comparison of the research method to current standard of care clinical tests. Cytotoxicity assays were performed on all samples positive by any modality. The Clostridium difficile Toxin/Antitoxin kit (TechLab, Blacksburg, VA) was used for the detection of C. difficile toxin in stool specimens by following manufacturer’s instructions. Specimens that showed characteristic cytotoxin activity after inoculation of MRC-5 tissue culture cells (rounding of the cells) which were neutralized by C. difficile antitoxin were considered positive for C. difficile toxin.

Results

Eighty-four stool samples from unique infants were collected during the study (Fig. 2). The number of samples collected from each NICU was unknown as no patient identifiers were maintained with the specimens. Seventy-one samples were EIA −/−, 7 samples were EIA +/− and 6 were EIA +/+. All 6 EIA +/+ samples were confirmed as toxigenic C. difficile by LAMP technology and also concurred with the results of the in house duplex PCR. Therefore, the point prevalence of toxigenic C. difficile in our NICU population was 7.1% (6/84). Cytotoxicity assay was performed on positive samples (by any test) for additional confirmation and was positive for 4/6 duplex PCR samples that were positive for toxigenic C. difficile; 2 samples could not be confirmed. Six of the 7 EIA +/− samples were negative for toxigenic C. difficile by LAMP technology and one sample was invalid. Our duplex PCR and the cytotoxicity assay were negative for all 7 of these samples. Our duplex PCR was negative for 69 of the 71 EIA −/− samples. The other 2 EIA −/− samples were positive for the tpi gene but negative for tcdB, indicating non-toxigenic C. difficile. Thus, the overall point prevalence of toxigenic (n = 6) and non-toxigenic (n = 2) C. difficile shedding in our NICU population was 9.5% (8/84) (Table 2).

Fig. 2
figure 2

Pathway for testing of stool samples collected from NICU babies using duplex PCR and standard clinical lab methods for the detection of Clostridium difficile

Full size image
Table 2 NICU stool samples positive for C. difficile by one or more modalities
Full size table

Discussion

The point prevalence of C. difficile stool shedding in hospitalized infants from two affiliated NICUs was examined utilizing standard clinical testing (EIA with reflexive molecular identification via LAMP) and an in house duplex PCR that identified toxigenic and non-toxigenic C. difficile strains. We hypothesized that the prevalence of NICU C. difficile shedding would be higher than previous reports in part due to increased sensitivity of molecular testing compared to the testing modalities used in most previous studies (culture, cytotoxicity assay and EIA). The increased sensitivity of molecular testing contributing to the increase in C. difficile prevalence has been observed in previous studies [44,45,46,47]. Additionally, we surmised that the epidemiologic changes in CDI as well as the advances in NICU care would contribute to a higher prevalence of C. difficile shedding in NICUs over time. However, on the contrary, we demonstrated a prevalence of 7.1% for toxigenic C. difficile and 9.5% for both toxigenic and non-toxigenic C. difficile strains, which is substantially less than previously published reports suggesting a mean prevalence of at least 21% in the NICU population [13, 18,19,20, 25, 30,31,32,33,34,35,36,37,38,39,40,41,42]. Our secondary aim was achieved in that our stool lysis technique and rapid duplex PCR had excellent concordance with commercial EIA and LAMP testing, and moderately good concordance with cytotoxicity tests. This suggests that the duplex PCR could be used more broadly for rapid, accurate clinical diagnosis and for further epidemiologic studies of C. difficile stool shedding with and without toxin production. Stool isolates testing +/− on EIA but negative by both LAMP and duplex PCR may have been from GDH cross-reactivity with other organisms [48, 49].

The identified difference between the prevalence of NICU C. difficile shedding in our study and previous studies may still be a reflection of advances in NICU practices. One important practice change is the emphasis of using human milk for feedings, perhaps decreasing the colonization of C. difficile in the infant gut [17, 22, 50, 51]. Another hypothesis for this change is the evolution of infection control measures with greater emphasis on caregiver hand hygiene and a transition from open ward NICUs to private patient rooms. These improvements in infection control within a NICU could decrease the transmission and thus prevalence of C. difficile shedding in the NICU environment.

Our study had several limitations. As no patient identifiers were maintained with the stool specimens, we were unable to obtain any clinical data on the infants. We were therefore unable to investigate possible clinical correlates with C. difficile shedding in these NICU infants. We did not test for the B1/NAP1/027 strain, which may contribute to increased incidence and severity of CDI, since we found a low prevalence of NICU C. difficile. Additionally, the use of previously frozen stool specimens may have impacted the sensitivities of the tests.

Additional NICU-based studies examining the clinical correlations of infant C. difficile colonization and shedding are needed to further answer questions regarding the epidemiologic changes in CDI. A lower point prevalence of NICU C. difficile as defined by our study is meaningful in that it informs sample size calculation for future work of clinical correlates of asymptomatic C. difficile colonization in the NICU. Potential future directions in NICU C. difficile colonization and shedding research include a follow-up survey of NICU infants with specific attention to mode of delivery, use of antibiotics, timing of initial feeding and number of hospitalization days. Additionally, as the epidemiology of CDI evolves, studies are needed to evaluate the potential for colonized NICU infants to serve as a reservoir or vector for transmission of toxigenic C. difficile strains to healthcare workers, the hospital environment, and vulnerable populations within and outside the hospital.

Abbreviations

CDI:

Clostridium difficile infection

EIA:

Enzyme immunoassay

GDH:

Glutamate dehydrogenase

HA-CDI:

Hospital acquired Clostridium difficile infection

LAMP:

Loop-mediated isothermal amplification

LMR:

Lysis microreactor

MLVA:

Multilocus variable number of tandem repeats analysis

NICU:

Neonatal Intensive Care Unit

References

  1. Lessa FC, Gould CV, McDonald LC. Current status of Clostridium difficile infection epidemiology. Clin Infect Dis. 2012;55(Suppl 2):S65–70.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Centers for Disease Control and Prevention (CDC). Severe Clostridium difficile-associated disease in populations previously at low risk--four states, 2005. MMWR Morb Mortal Wkly Rep. 2005;54(47):1201–5.

    Google Scholar 

  3. Chitnis AS, Holzbauer SM, Belflower RM, Winston LG, Bamberg WM, Lyons C, Farley MM, Dumyati GK, Wilson LE, Beldavs ZG, Dunn JR, Gould LH, Maccannell DR, Gerding DN, McDonald LC, Lessa FC. Epidemiology of community-associated Clostridium difficile infection, 2009 through 2011. JAMA Intern Med. 2013;173(14):1359–67.

    Article  PubMed  Google Scholar 

  4. Kuntz JL, Chrischilles EA, Pendergast JF, Herwaldt LA, Polgreen PM. Incidence of and risk factors for community-associated Clostridium difficile infection: a nested case-control study. BMC Infect Dis. 2011;11:194.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Riggs MM, Sethi AK, Zabarsky TF, Eckstein EC, Jump RL, Donskey CJ. Asymptomatic carriers are a potential source for transmission of epidemic and nonepidemic Clostridium difficile strains among long-term care facility residents. Clin Infect Dis. 2007;45(8):992–8.

    Article  PubMed  Google Scholar 

  6. Clabots CR, Johnson S, Olson MM, Peterson LR, Gerding DN. Acquisition of Clostridium difficile by hospitalized patients: evidence for colonized new admissions as a source of infection. J Infect Dis. 1992;166(3):561–7.

    Article  CAS  PubMed  Google Scholar 

  7. Curry SR, Muto CA, Schlackman JL, Pasculle AW, Shutt KA, Marsh JW, Harrison LH. Use of multilocus variable number of tandem repeats analysis genotyping to determine the role of asymptomatic carriers in Clostridium difficile transmission. Clin Infect Dis. 2013;57(8):1094–102.

    Article  PubMed  PubMed Central  Google Scholar 

  8. Hecker MT, Riggs MM, Hoyen CK, Lancioni C, Donskey CJ. Recurrent infection with epidemic Clostridium difficile in a peripartum woman whose infant was asymptomatically colonized with the same strain. Clin Infect Dis. 2008;46(6):956–7.

    Article  PubMed  Google Scholar 

  9. McFarland LV, Surawicz CM, Greenberg RN, Bowen KE, Melcher SA, Mulligan ME. Possible role of cross-transmission between neonates and mothers with recurrent Clostridium difficile infections. Am J Infect Control. 1999;27(3):301–3.

    Article  CAS  PubMed  Google Scholar 

  10. Rousseau C, Poilane I, De Pontual L, Maherault AC, Le Monnier A, Collignon A. Clostridium difficile carriage in healthy infants in the community: a potential reservoir for pathogenic strains. Clin Infect Dis. 2012;55(9):1209–15.

    Article  PubMed  Google Scholar 

  11. Stoesser N, Crook DW, Fung R, Griffiths D, Harding RM, Kachrimanidou M, Keshav S, Peto TE, Vaughan A, Walker AS, Dingle KE. Molecular epidemiology of Clostridium difficile strains in children compared with that of strains circulating in adults with Clostridium difficile-associated infection. J Clin Microbiol. 2011;49(11):3994–6.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Blixt T, Gradel KO, Homann C, Seidelin JB, Schønning K, Lester A, Houlind J, Stangerup M, Gottlieb M, Knudsen JD. Asymptomatic carriers contribute to nosocomial Clostridium difficile infection: a cohort study of 4508 patients. Gastroenterology. 2017;152(5):1031–41. e2

    Article  PubMed  Google Scholar 

  13. Al-Jumaili IJ, Shibley M, Lishman AH, Record CO. Incidence and origin of Clostridium difficile in neonates. J Clin Microbiol. 1984;19(1):77–8.

    CAS  PubMed  PubMed Central  Google Scholar 

  14. Bacon AE, Fekety R, Schaberg DR, Faix RG. Epidemiology of Clostridium difficile colonization in newborns: results using a bacteriophage and bacteriocin typing system. J Infect Dis. 1988;158(2):349–54.

    Article  CAS  PubMed  Google Scholar 

  15. Bolton RP, Tait SK, Dear PR, Losowsky MS. Asymptomatic neonatal colonisation by Clostridium difficile. Arch Dis Child. 1984;59(5):466–72.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Collignon A, Ticchi L, Depitre C, Gaudelus J, Delmee M, Corthier G. Heterogeneity of Clostridium difficile isolates from infants. Eur J Pediatr. 1993;152(4):319–22.

    Article  CAS  PubMed  Google Scholar 

  17. Cooperstock M, Riegle L, Woodruff CW, Onderdonk A. Influence of age, sex, and diet on asymptomatic colonization of infants with Clostridium difficile. J Clin Microbiol. 1983;17(5):830–3.

    CAS  PubMed  PubMed Central  Google Scholar 

  18. Donta ST, Myers MG. Clostridium difficile toxin in asymptomatic neonates. J Pediatr. 1982;100(3):431–4.

    Article  CAS  PubMed  Google Scholar 

  19. Enad D, Meislich D, Brodsky NL, Hurt H. Is Clostridium difficile a pathogen in the newborn intensive care unit? A prospective evaluation. J Perinatol. 1997;17(5):355–9.

    CAS  PubMed  Google Scholar 

  20. Faden HS, Dryja D. Importance of asymptomatic shedding of Clostridium difficile in environmental contamination of a neonatal intensive care unit. Am J Infect Control. 2015;43(8):887–8.

    Article  PubMed  Google Scholar 

  21. Holst E, Helin I, Mardh PA. Recovery of Clostridium difficile from children. Scand J Infect Dis. 1981;13(1):41–5.

    Article  CAS  PubMed  Google Scholar 

  22. Jangi S, Lamont JT. Asymptomatic colonization by clostridium difficile in infants: implications for disease in later life. J Pediatr Gastroenterol Nutr. 2010;51(1):2–7.

    Article  PubMed  Google Scholar 

  23. Larson HE, Barclay FE, Honour P, Hill ID. Epidemiology of Clostridium difficile in infants. J Infect Dis. 1982;146(6):727–33.

    Article  CAS  PubMed  Google Scholar 

  24. Penders J, Stobberingh EE, van den Brandt PA, van Ree R, Thijs C. Toxigenic and non-toxigenic Clostridium difficile: determinants of intestinal colonisation and role in childhood atopic manifestations. Gut. 2008;57(7):1025–6.

    Article  CAS  PubMed  Google Scholar 

  25. Sherertz RJ, Sarubbi FA. The prevalence of Clostridium difficile and toxin in a nursery population: a comparison between patients with necrotizing enterocolitis and an asymptomatic group. J Pediatr. 1982;100(3):435–9.

    Article  CAS  PubMed  Google Scholar 

  26. Stark PL, Lee A, Parsonage BD. Colonization of the large bowel by Clostridium difficile in healthy infants: quantitative study. Infect Immun. 1982;35(3):895–9.

    CAS  PubMed  PubMed Central  Google Scholar 

  27. Svedhem A, Kaijser B, MacDowall I. Intestinal occurrence of campylobacter fetus subspecies jejuni and Clostridium difficile in children in Sweden. Eur J Clin Microbiol. 1982;1(1):29–32.

    Article  CAS  PubMed  Google Scholar 

  28. Viscidi R, Willey S, Bartlett JG. Isolation rates and toxigenic potential of Clostridium difficile isolates from various patient populations. Gastroenterology. 1981;81(1):5–9.

    CAS  PubMed  Google Scholar 

  29. Wongwanich S, Pongpech P, Dhiraputra C, Huttayananont S, Sawanpanyalert P. Characteristics of Clostridium difficile strains isolated from asymptomatic individuals and from diarrheal patients. Clin Microbiol Infect. 2001;7(8):438–41.

    Article  CAS  PubMed  Google Scholar 

  30. Alfa MJ, Robson D, Davi M, Bernard K, Van Caeseele P, Harding GK. An outbreak of necrotizing enterocolitis associated with a novel clostridium species in a neonatal intensive care unit. Clin Infect Dis. 2002;35(Suppl 1):S101–5.

    Article  PubMed  Google Scholar 

  31. Blakey JL, Lubitz L, Barnes GL, Bishop RF, Campbell NT, Gillam GL. Development of gut colonisation in pre-term neonates. J Med Microbiol. 1982;15(4):519–29.

    Article  CAS  PubMed  Google Scholar 

  32. Cardines R, Luzzi I, Menichella G, Virgili Q, Mastrantonio P. Clostridium difficile in preterm neonates. Microbiologica. 1988;11(3):259–61.

    CAS  PubMed  Google Scholar 

  33. Chang JY, Shim JO, Ko JS, Seo JK, Lee JA, Kim HS, Choi JH, Shin S, Shin SM. Monitoring of Clostridium difficile colonization in preterm infants in neonatal intensive care units. Pediatr Gastroenterol Hepatol Nutr. 2012;15(1):29–37.

    Article  Google Scholar 

  34. el-Mohandes AE, Keiser JF, Refat M, Jackson BJ. Prevalence and toxigenicity of Clostridium difficile isolates in fecal microflora of preterm infants in the intensive care nursery. Biol Neonate. 1993;63(4):225–9.

    Article  CAS  PubMed  Google Scholar 

  35. Ferraris L, Butel MJ, Campeotto F, Vodovar M, Roze JC, Aires J. Clostridia in premature neonates’ gut: incidence, antibiotic susceptibility, and perinatal determinants influencing colonization. PLoS One. 2012;7(1):e30594.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Kato H, Kato N, Watanabe K, Ueno K, Ushijima H, Hashira S, Abe T. Application of typing by pulsed-field gel electrophoresis to the study of Clostridium difficile in a neonatal intensive care unit. J Clin Microbiol. 1994;32(9):2067–70.

    CAS  PubMed  PubMed Central  Google Scholar 

  37. Kim KH, Fekety R, Batts DH, Brown D, Cudmore M, Silva J Jr, Waters D. Isolation of Clostridium difficile from the environment and contacts of patients with antibiotic-associated colitis. J Infect Dis. 1981;143(1):42–50.

    Article  CAS  PubMed  Google Scholar 

  38. Lishman AH, Al Jumaili IJ, Elshibly E, Hey E, Record CO. Clostridium difficile isolation in neonates in a special care unit. Lack of correlation with necrotizing enterocolitis. Scand J Gastroenterol. 1984;19(3):441–4.

    CAS  PubMed  Google Scholar 

  39. Malamou-Ladas H, O'Farrell S, Nash JQ, Tabaqchali S. Isolation of Clostridium difficile from patients and the environment of hospital wards. J Clin Pathol. 1983;36(1):88–92.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Phua TJ, Rogers TR, Pallett AP. Prospective study of Clostridium difficile colonization and paracresol detection in the stools of babies on a special care unit. J Hyg (Lond). 1984;93(1):17–25.

    Article  CAS  Google Scholar 

  41. Tina LG, Proto N, Sciacca A. Asymptomatic intestinal colonization by Clostridium difficile in preterm neonates. Pediatr Infect Dis J. 1994;13(12):1158–9.

    Article  CAS  PubMed  Google Scholar 

  42. Zedd AJ, Sell TL, Schaberg DR, Fekety FR, Cooperstock MS. Nosocomial Clostridium difficile reservoir in a neonatal intensive care unit. Pediatr Infect Dis. 1984;3(5):429–32.

    Article  CAS  PubMed  Google Scholar 

  43. Freifeld AG, Simonsen KA, Booth CS, Zhao X, Whitney SE, Karre T, Iwen PC, Viljoen HJ. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing. J Mol Diagn. 2012;14(3):274–9.

    Article  CAS  PubMed  Google Scholar 

  44. de Jong E, de Jong AS, Bartels CJ, van der Rijt-van den Biggelaar C, Melchers WJ, Sturm PD. Clinical and laboratory evaluation of a real-time PCR for Clostridium difficile toxin a and B genes. Eur J Clin Microbiol Infect Dis. 2012;31(9):2219–25.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Fong KS, Fatica C, Hall G, Procop G, Schindler S, Gordon SM, Fraser TG. Impact of PCR testing for Clostridium difficile on incident rates and potential on public reporting: is the playing field level? Infect Control Hosp Epidemiol. 2011;32(9):932–3.

    Article  PubMed  Google Scholar 

  46. Gould CV, Edwards JR, Cohen J, Bamberg WM, Clark LA, Farley MM, Johnston H, Nadle J, Winston L, Gerding DN, McDonald LC, Lessa FC, Clostridium difficile Infection Surveillance Investigators, Centers for Disease Control and Prevention. Effect of nucleic acid amplification testing on population-based incidence rates of Clostridium difficile infection. Clin Infect Dis. 2013;57(9):1304–7.

    Article  CAS  PubMed  Google Scholar 

  47. Koo HL, Van JN, Zhao M, Ye X, Revell PA, Jiang ZD, Grimes CZ, Koo DC, Lasco T, Kozinetz CA, Garey KW, DuPont HL. Real-time polymerase chain reaction detection of asymptomatic Clostridium difficile colonization and rising C. Difficile-associated disease rates. Infect Control Hosp Epidemiol. 2014;35(6):667–73.

    Article  PubMed  Google Scholar 

  48. Lyerly DM, Ball DW, Toth J, Wilkins TD. Characterization of cross-reactive proteins detected by Culturette brand rapid latex test for Clostridium difficile. J Clin Microbiol. 1988;26(3):397–400.

    CAS  PubMed  PubMed Central  Google Scholar 

  49. Miles BL, Siders JA, Allen SD. Evaluation of a commercial latex test for Clostridium difficile for reactivity with C. Difficile and cross-reactions with other bacteria. J Clin Microbiol. 1988;26(11):2452–5.

    CAS  PubMed  PubMed Central  Google Scholar 

  50. Penders J, Vink C, Driessen C, London N, Thijs C, Stobberingh EE. Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR. FEMS Microbiol Lett. 2005;243(1):141–7.

    Article  CAS  PubMed  Google Scholar 

  51. Vael C, Desager K. The importance of the development of the intestinal microbiota in infancy. Curr Opin Pediatr. 2009;21(6):794–800.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

The authors would like to acknowledge Dr. Henrik Viljoen, PhD for contributions to the development of the duplex PCR methodology utilized in the study, Alyssa Hornay for technical support in performing the cytotoxicity assay, and the Cheryl Lozier Pediatric Research Foundation for providing financial support to the study.

Funding

1. Cheryl Lozier Research Foundation- funding for PCR reagents and supplies.

2. University of Nebraska Medical Center, Clinical Research Center-funding for comparative clinically-available tests (EIA and LAMP).

Availability of data and materials

All data generated or analyzed in this study are included in this manuscript, and any additional raw data may be available from the corresponding author on reasonable request.

Author information

Authors and Affiliations

  1. Adult Infectious Diseases, University of Nebraska Medical Center, Omaha, NE, USA

    Andrea Green Hines & Alison Freifeld

  2. Pediatric Infectious Diseases, University of Nebraska Medical Center, Omaha, NE, USA

    Andrea Green Hines, Xing Zhao & Kari A. Simonsen

  3. Neonatology, University of Nebraska Medical Center, Omaha, NE, USA

    Ann Anderson Berry & Lynne Willett

  4. Pathology and Microbiology, University of Nebraska Medical Center, Omaha, NE, USA

    Peter C. Iwen

Authors
  1. Andrea Green Hines
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Alison Freifeld
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Xing Zhao
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Ann Anderson Berry
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Lynne Willett
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Peter C. Iwen
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Kari A. Simonsen
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

AGH contributed to study design, data collection, analysis, and interpretation, and manuscript writing. AF contributed to study conception and design, data analysis and interpretation and manuscript writing. XZ contributed to study conception and design, data collection, analysis, and interpretation. Performed study-related PCR and gel electrophoresis. AAB contributed to study design, data collection, analysis, and interpretation and manuscript writing. LW contributed to study design, data collection, analysis, and interpretation and manuscript critical revisions. PCI contributed to study design, data analysis and interpretation, cytotoxicity assay performance, and critical manuscript revisions. KAS contributed to study design, data collection, analysis and interpretation and manuscript writing. All authors have given final approval for the submitted version of the manuscript.

Corresponding author

Correspondence to Kari A. Simonsen.

Ethics declarations

Ethics approval and consent to participate

Ethics approval was granted by the University of Nebraska Medical Center Institutional Review Board as #652-11EP as non-human subjects research not requiring informed consent and in conjunction with Institutional Biosafety Committee approval #10–02-003-BL2 for molecular laboratory diagnostics defined at BSL-2.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Hines, A.G., Freifeld, A., Zhao, X. et al. Clostridium difficile stool shedding in infants hospitalized in two neonatal intensive care units is lower than previous point prevalence estimates using molecular diagnostic methods. BMC Pediatr 18, 137 (2018). https://0-doi-org.brum.beds.ac.uk/10.1186/s12887-018-1113-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12887-018-1113-z

Keywords

BMC Pediatrics

ISSN: 1471-2431

Contact us